View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_187 (Length: 295)
Name: NF11386A_low_187
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_187 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 25933214 - 25933416
Alignment:
| Q |
10 |
agaatatagaactttaatttaaatgttttgtgactaagcatctcaataaatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933214 |
agaatatagaactttaatttaaatgttttgtgactaagcatctcaataaatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgttt |
25933313 |
T |
 |
| Q |
110 |
ttattaaactaagttgaacgccctttctctaaaaatcagaaagttaacatcaaaacacaataat---ggtttgttcttgaaaaatgattaatttaacata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25933314 |
ttattaaactaagttgaacgccctttctctgaaaatcagaaagttaacatcaaaatacaataattacggtttgttcttgaaaaatgattaatttaacata |
25933413 |
T |
 |
| Q |
207 |
caa |
209 |
Q |
| |
|
||| |
|
|
| T |
25933414 |
caa |
25933416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University