View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_195 (Length: 290)
Name: NF11386A_low_195
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_195 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 23 - 275
Target Start/End: Original strand, 42195258 - 42195510
Alignment:
| Q |
23 |
atcagaagctatgtatcaccgacacttcgaattaaatgcgtgtctagggtccaacctgtgtcagtgttactgacacgacacagacacatatgattatatt |
122 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
42195258 |
atcagaagctatgtatcaccaacacttcgaattaaatgcgtgtctagggtccaacctgtgtcagtgttactaacacgacacggacacatatgattatatt |
42195357 |
T |
|
| Q |
123 |
caattgttttctcaaattattttactagtatggaagtgtaagtgccgatgttgagccatgtatgtgtcaatgctctatagatcagaagagatcgtattat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42195358 |
caattgttttctcaaattattttactagtatggaagtgtaagtgccgatgttgagccatgtatgtgtcaatgctctatagatcagaagagatcgtattat |
42195457 |
T |
|
| Q |
223 |
aattttcaagatcagttgtttcattcactgccccagtcaaattaagaggtgat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
42195458 |
tattttcaagatcagttgtttcattcactgcctcagttaaattaagaggtgat |
42195510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 127
Target Start/End: Complemental strand, 25280458 - 25280422
Alignment:
| Q |
91 |
actgacacgacacagacacatatgattatattcaatt |
127 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
25280458 |
actgacacgacacaaacacatgtgattatattcaatt |
25280422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University