View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_196 (Length: 289)
Name: NF11386A_low_196
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_196 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 280
Target Start/End: Original strand, 6992599 - 6992849
Alignment:
| Q |
22 |
ttagattcttttgattggagttggaccaagtcgtaattggaatttggatattccgttaaactgtctctttattaaacttttctccgtttttatttttagt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| | |
|
|
| T |
6992599 |
ttagattcttttgattggagttggaccaagtcgtaattggaatttggatattccgttaaactgtctctttattaaacttttttc--------tttttaat |
6992690 |
T |
|
| Q |
122 |
cgatgcattttacacacaactacatagcttaatctattgaaccatggtaacggtaactagatacactctatttcatttcgaaacctgaaaaataacttat |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6992691 |
cgatgcattttgcacacaactacatagcttaatctattaaacgatggtaacggtaactagatacactctatttcaattcgaaacctgtaaaataacttat |
6992790 |
T |
|
| Q |
222 |
catttgatttaagtgtttagattcttacattttagtttttgacctcaaagtatattatt |
280 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6992791 |
catttgatttaagtgtctagattcttacattttagtttttgacctcaaagtatattatt |
6992849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University