View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_197 (Length: 289)
Name: NF11386A_low_197
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_197 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 147 - 278
Target Start/End: Complemental strand, 15887286 - 15887155
Alignment:
| Q |
147 |
caattgtcattggtctaacaacatttaactgtcggactttttagcggcagctaagtgtcgtttgacacttttaaaatcgattaaatcgctctaaaaagtg |
246 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15887286 |
caattgtcgttggtccaacgacatttaactgtcggacttttcagcggcaactaagtgtcgtttgacacttttaaaatcgattaaaccgctctaaaaagtg |
15887187 |
T |
|
| Q |
247 |
ttggacgacacttatccaccacttttttaaca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15887186 |
ttggacgacacttatccaccacttttttaaca |
15887155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 15887432 - 15887315
Alignment:
| Q |
1 |
gcccacttccgtcgtgtttgtttataattcatcacgaaaagaagatatttgaattttagcagaacttcaatatgctttccggagaccaagaaaagggata |
100 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
15887432 |
gcccacttccttcttgtttgtttatacttcatcacgaaaagaagatatttgaattttagcagaacttcaatatgctttccgtagaccaagaaaaaggata |
15887333 |
T |
|
| Q |
101 |
agccaatgaaaaatactc |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
15887332 |
agccaatgaaaaatactc |
15887315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University