View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_209 (Length: 284)
Name: NF11386A_low_209
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_209 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 4 - 183
Target Start/End: Original strand, 4797433 - 4797608
Alignment:
| Q |
4 |
atgaatggaaaggtatcctataattgacagttactaggatttaagttagggtacgtactttgatgattattaatatcatcctcaatatgaggccatgttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4797433 |
atgaatggaaaggtatcctataattgacagttactaggatttaagttagggtac----tttgacgattattaatatcatcctcaatatgaggccatgttt |
4797528 |
T |
|
| Q |
104 |
gaatgattaattatgatataggagtatcagttattgaaatttgagaacttgccaattatggctattccaaattccatgtc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4797529 |
gaatgattaattatgatataggagtatcagttattgaaatttgagaacttgccaattatggctattccaaattccatgtc |
4797608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 4791950 - 4791991
Alignment:
| Q |
4 |
atgaatggaaaggtatcctataattgacagttactaggattt |
45 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
4791950 |
atgaatggaagtgtttcctataattgacagttactaggattt |
4791991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 224
Target Start/End: Complemental strand, 4788153 - 4788078
Alignment:
| Q |
148 |
gaacttgccaattatggctattccaaattccatgtcgtgtgtaaggaactaagtgtaatacttttgagtcaaaattc |
224 |
Q |
| |
|
||||||| ||||||| | ||||| |||||| ||||| ||||||||| ||| ||||||||||| | ||||||||||| |
|
|
| T |
4788153 |
gaacttgtcaattattg-tattcgaaattcaatgtcatgtgtaagggactgagtgtaatactcataagtcaaaattc |
4788078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University