View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_214 (Length: 279)
Name: NF11386A_low_214
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_214 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 6 - 274
Target Start/End: Original strand, 43767496 - 43767764
Alignment:
| Q |
6 |
gtcaacttttaagctcctttgcttatctatttcacagaaatatagataaagacacataaaatataaaaagttcaatgtcatttaaactttagtaacactt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43767496 |
gtcaacttttaagctcctttgcttatctatttcacataaatatagataaagacacataaaatataaaaagttcaatgtcatttaaactttagtaacactt |
43767595 |
T |
|
| Q |
106 |
ggaactttcctctcctccatgtcttgtctaattcatctcattggaatctctcgctctccatgacaaattatgattccatacggtcactttttacacgcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43767596 |
ggaactttcctctcctccatgtcttgtctaattcatctcattggaatctctcgctctccatgacaaattatgattccatacggtcattttttacacgcat |
43767695 |
T |
|
| Q |
206 |
tcacactgtcaggactttagtggtcgtccaatcttgattggatcttttagaaaatgaagatttaatttt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43767696 |
tcacactgtcaggactttagtggtcgtccaatcttgattggatcgtttagaaaatgaagatttaatttt |
43767764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University