View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_221 (Length: 276)
Name: NF11386A_low_221
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_221 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 7 - 267
Target Start/End: Original strand, 29007362 - 29007622
Alignment:
| Q |
7 |
taaaagtgacttcaactgtgtatttcctttgtgaaggtgagaacaagaacgtgtttgaagatgttaagagagcccgttttgtttatgcttacaatggtca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29007362 |
taaaagtgacttcaactgtgtatttcctttgtgaaggggagaacaagaacgtgtttgaagatgttaagagagctcgttttgtttatgcttacaatggtca |
29007461 |
T |
 |
| Q |
107 |
acaatcttggaaggttagattctattatgcttttttaaaattaagataaatttggttttgtgtccattctaaggtagttcatttgaagttagttaatcaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29007462 |
acaatcttggaaggttagattctattatgcttttttaaaattaagataaatttgattttatgtccattctgaggtagttcatttgaagttagttaatcaa |
29007561 |
T |
 |
| Q |
207 |
tcgtgtaatacacgtgttttagtgtttctgtttacactttcaaatttggttgtatattctt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29007562 |
tcgtgtaatacacgtgttttagtgtttctgtttacactttcaaatttggttgtatgttctt |
29007622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University