View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_23 (Length: 454)
Name: NF11386A_low_23
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 3e-83; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 31069237 - 31069397
Alignment:
| Q |
18 |
acaatcacccatcaagatgatttcaccaatatcgattcaagtttcatagaaaacaccgaagacaaaatgaaagaaattgcttcagttcttccaaaaatgg |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069237 |
acaaacacccatcaagatgatttcaccaatatcgattcaagtttcatagaaaacaccgaagacaaaatgaaagaaattgcttcagttcttccaaaaatgg |
31069336 |
T |
|
| Q |
118 |
tcaaggaatatcacaagattcatctcaacacatttcgttaatataaataagaagataatag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069337 |
tcaaggaatatcacaagattcatctcaacacatttcgttaatataaataagaagataatag |
31069397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 241 - 310
Target Start/End: Original strand, 31069460 - 31069529
Alignment:
| Q |
241 |
atgtcttcttccttcagcaaggtgatgttaagcttcaaaaccattccccctattcttcacttgtgtctct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069460 |
atgtcttcttccttcagcaaggtgatgttaagcttcaaaaccattccccctattcttcacttgtgtctct |
31069529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 377 - 452
Target Start/End: Original strand, 31069596 - 31069671
Alignment:
| Q |
377 |
atgaagttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaataatctagcca |
452 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
31069596 |
atgaagttgttcttctgctacttgaaagattttgcgggaagagaaatgacggtagaactcaagaatgatttagcca |
31069671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 441
Target Start/End: Original strand, 37614334 - 37614398
Alignment:
| Q |
377 |
atgaagttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaa |
441 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
37614334 |
atgaagctgttcttctcgtacttcaaagatttggtgggaagagaagtgacggttgaactcaagaa |
37614398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 441
Target Start/End: Original strand, 42440446 - 42440506
Alignment:
| Q |
381 |
agttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaa |
441 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
42440446 |
agttgttcttctcatacttcaaagatttggtgggaagagaagttacggtagaactcaagaa |
42440506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 24 - 142
Target Start/End: Complemental strand, 11593109 - 11592990
Alignment:
| Q |
24 |
acccatcaagatgatttcaccaatatcgattcaagtttcatagaaaacaccgaagacaaaatgaaagaaattgcttcagttcttccaaaaat-ggtcaag |
122 |
Q |
| |
|
||||||||| | |||| |||||| || ||||| ||||||||||||||||| |||||| ||| |||||| |||||| ||||||||||| || ||||||| |
|
|
| T |
11593109 |
acccatcaacaagattacaccaacatggattctggtttcatagaaaacaccaaagacagaatcaaagaagctgcttctgttcttccaaacatgggtcaag |
11593010 |
T |
|
| Q |
123 |
gaatatcacaagattcatct |
142 |
Q |
| |
|
|||| ||||||||| ||||| |
|
|
| T |
11593009 |
gaatttcacaagatgcatct |
11592990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 24 - 142
Target Start/End: Original strand, 11645010 - 11645129
Alignment:
| Q |
24 |
acccatcaagatgatttcaccaatatcgattcaagtttcatagaaaacaccgaagacaaaatgaaagaaattgcttcagttcttccaaaaat-ggtcaag |
122 |
Q |
| |
|
||||||||| | |||| |||||| || ||||| ||||||||||||||||| |||||| ||| |||||| |||||| ||||||||||| || ||||||| |
|
|
| T |
11645010 |
acccatcaacaagattacaccaacatggattctggtttcatagaaaacaccaaagacagaatcaaagaagctgcttctgttcttccaaacatgggtcaag |
11645109 |
T |
|
| Q |
123 |
gaatatcacaagattcatct |
142 |
Q |
| |
|
|||| ||||||||| ||||| |
|
|
| T |
11645110 |
gaatttcacaagatgcatct |
11645129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University