View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11386A_low_234 (Length: 271)

Name: NF11386A_low_234
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11386A_low_234
NF11386A_low_234
[»] chr5 (1 HSPs)
chr5 (10-247)||(2956817-2957058)


Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 2957058 - 2956817
Alignment:
10 aatatttttgaaccgcttaggagaggaggtacgttggagggaagaggcaaaaaatgagtacaacttgcaaccatagctttggttgcttgtgatgaaacca 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
2957058 aatatttttgaaccgcttaggagaggaggtacgttggagggaagaggcaaaaaatgagtacaacttgcaaccatagctttggttgcttgtgaggaaacca 2956959  T
110 ----cataagaaaaaccaacaatgggaatgggagactttagtggatctgaactcgcgctgcaaaataaaactcaacgacttcatcattaattctgcaaaa 205  Q
        |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2956958 accacataagaacaaccaacaatgggaatgggagactttagtggacctgaactcgcgctgcaaaataaaactcaacgacttcatcattaattctgcaaaa 2956859  T
206 taaagaaacatgaagttaaatccatacatggaaaaataataa 247  Q
    ||||||||||| |||||||| |||||||||||||||||||||    
2956858 taaagaaacataaagttaaaaccatacatggaaaaataataa 2956817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University