View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_234 (Length: 271)
Name: NF11386A_low_234
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_234 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 2957058 - 2956817
Alignment:
| Q |
10 |
aatatttttgaaccgcttaggagaggaggtacgttggagggaagaggcaaaaaatgagtacaacttgcaaccatagctttggttgcttgtgatgaaacca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2957058 |
aatatttttgaaccgcttaggagaggaggtacgttggagggaagaggcaaaaaatgagtacaacttgcaaccatagctttggttgcttgtgaggaaacca |
2956959 |
T |
|
| Q |
110 |
----cataagaaaaaccaacaatgggaatgggagactttagtggatctgaactcgcgctgcaaaataaaactcaacgacttcatcattaattctgcaaaa |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2956958 |
accacataagaacaaccaacaatgggaatgggagactttagtggacctgaactcgcgctgcaaaataaaactcaacgacttcatcattaattctgcaaaa |
2956859 |
T |
|
| Q |
206 |
taaagaaacatgaagttaaatccatacatggaaaaataataa |
247 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
2956858 |
taaagaaacataaagttaaaaccatacatggaaaaataataa |
2956817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University