View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_255 (Length: 265)
Name: NF11386A_low_255
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_255 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 262
Target Start/End: Original strand, 50157005 - 50157260
Alignment:
| Q |
7 |
tcgttagaatttcggaatggtttgaatgcactctaaaagttgatgttggacaagnnnnnnngccgagcagcatattcactggtacattgttatccaaaag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50157005 |
tcgttagaatttcggaatggtttgaatgcactctaaaagttgaggttggacaagtttttttgccgagcagcatattcactggtacattgttatccaaaag |
50157104 |
T |
|
| Q |
107 |
tcttctatacataacttgaaaactcgtcacttttactgtaactgagttcaattatttaatcgaaatcaagcaattatgatctccaaggcactgtctcggt |
206 |
Q |
| |
|
| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
50157105 |
tattctatacataacttgaacactcgtcacttttactgtaactgagttcaattatttaatcgaaatcaagcaattataatctccaaggcactgtctcagt |
50157204 |
T |
|
| Q |
207 |
tggcaaaacataatagagcggagtgcatggatgttggaacttaattgttttggtct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50157205 |
tggcaaaacataatagagcggagtgcatggatgttggaacttaattgttttggtct |
50157260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University