View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_259 (Length: 264)
Name: NF11386A_low_259
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_259 |
 |  |
|
| [»] chr8 (20 HSPs) |
 |  |
|
| [»] scaffold1318 (1 HSPs) |
 |  |  |
|
| [»] scaffold0570 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 20)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 6483510 - 6483773
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttgttgttgtaatttgctataggtacattgatagtaatcaaattaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6483510 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttgttgttgtaatttgctataggtacattgatagtgatcaaattaa |
6483609 |
T |
 |
| Q |
101 |
gaatttgtgtttttaacttctaaacaatctatctgtgcgagcaatagtataacattagaggtgatgtgggagaaaatcaccttttggtgaatggtaatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6483610 |
gaatttgtgtttttaacttctaaacaatctatctgtgcgagcaatagtataacattagaggtgatgtgggagaaaatcaccttttggtgaatggtaatat |
6483709 |
T |
 |
| Q |
201 |
tgcgtaggaacctaatgatattatgctattgttgctaccttgtgttctttattttttattttga |
264 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6483710 |
tgtgcaggaacctaatgatattatgctattgttgctactttgtgttctttattttttattttga |
6483773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 44047584 - 44047543
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
44047584 |
tttgatccatgtagctgaccccacttagtgggataaggcttg |
44047543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 45041368 - 45041327
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
45041368 |
tttgatccatgtagctgaccccacttagtgggataaggcttg |
45041327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 490565 - 490608
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttgtt |
59 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
490565 |
tttgatccatgtagccgaccccacttagtgggataaggcttgtt |
490608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 57
Target Start/End: Original strand, 5057595 - 5057637
Alignment:
| Q |
15 |
gtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
5057595 |
gtttgatccatgtaactgatcctacttagtgggataaggcttg |
5057637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 12491190 - 12491140
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgta |
65 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
12491190 |
tttgatccatgtagccgaccccacttagtgggataaggcttagttgttgta |
12491140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 30812869 - 30812827
Alignment:
| Q |
15 |
gtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
30812869 |
gtttgattcatgtagccgaccccacttagtgggaaaaggcttg |
30812827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 1928639 - 1928598
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
1928639 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
1928598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 57
Target Start/End: Complemental strand, 3638391 - 3638346
Alignment:
| Q |
12 |
gttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
3638391 |
gttgtttgttccatggagctgaccccacttagtgggataaggcttg |
3638346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 11523775 - 11523734
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
11523775 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
11523734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 14742134 - 14742093
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
14742134 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
14742093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 25473455 - 25473414
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
25473455 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
25473414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 32931190 - 32931231
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
32931190 |
tttgatccatgtagccgaccccacttagtgggaaaagccttg |
32931231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 36395000 - 36394951
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgt |
64 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||| |||||||| |
|
|
| T |
36395000 |
tttgatccatgtagccgaccccacttagtgggataaggcttcgttgttgt |
36394951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 36545379 - 36545420
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
36545379 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
36545420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 36565299 - 36565254
Alignment:
| Q |
10 |
gcgttgtttgatccatgtagctgaccctacttagtgggaaaaggct |
55 |
Q |
| |
|
||||| ||||||||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
36565299 |
gcgttatttgatccatgtagccgaccccacttagtgggataaggct |
36565254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 42469779 - 42469738
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
42469779 |
tttgatccatgtagctgaccccacttattgggataaggcttg |
42469738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 44529455 - 44529496
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
44529455 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
44529496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 44699696 - 44699737
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||||||||| |
|
|
| T |
44699696 |
tttgatccctgtagcagaccccacttagtgggaaaaggcttg |
44699737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 45419465 - 45419506
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
45419465 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
45419506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 30)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 20158723 - 20158682
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20158723 |
tttgatccatgtagctgaccctacttagtgggataaggcttg |
20158682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 9210756 - 9210707
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgt |
64 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| |||||||| |
|
|
| T |
9210756 |
tttgatccatgtagctgaccccacttagtgggataaggcttcgttgttgt |
9210707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 31681072 - 31681031
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
31681072 |
tttgatccatgtagccgaccccacttagtgggaaaaggcttg |
31681031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 40630664 - 40630705
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
40630664 |
tttgatccatgtagccgaccccacttagtgggaaaaggcttg |
40630705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 34745971 - 34746018
Alignment:
| Q |
10 |
gcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
34745971 |
gcgttgtttgattcatgtagccgaccccacttagtgggataaggcttg |
34746018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 6263489 - 6263543
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgtaattt |
69 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||| |||||||| |||| |
|
|
| T |
6263489 |
tttgatccatgtagccgaccccacttagtgggataaggcttggttgttgttattt |
6263543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 2885774 - 2885733
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
2885774 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
2885733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 6375098 - 6375139
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
6375098 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
6375139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 7273330 - 7273371
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
7273330 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
7273371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 11594190 - 11594231
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
11594190 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
11594231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 12841327 - 12841286
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
12841327 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
12841286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 57
Target Start/End: Original strand, 26847832 - 26847877
Alignment:
| Q |
12 |
gttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||| |||||||| |
|
|
| T |
26847832 |
gttgtttgatccacgtagccgacccgacttagtgggataaggcttg |
26847877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 27649010 - 27649051
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
27649010 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
27649051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 28208380 - 28208339
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
28208380 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
28208339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 28708611 - 28708652
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
28708611 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
28708652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 29650614 - 29650655
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
29650614 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
29650655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 30814177 - 30814136
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
30814177 |
tttgatccatgtagccgaccccacttagtgggaagaggcttg |
30814136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 31005435 - 31005476
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
31005435 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
31005476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 31682654 - 31682613
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
31682654 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
31682613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 31869154 - 31869113
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
31869154 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
31869113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 34869650 - 34869691
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
34869650 |
tttgatccatgtagccgaccctaattagtgggataaggcttg |
34869691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 35906253 - 35906212
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
35906253 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
35906212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 36101829 - 36101788
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
36101829 |
tttgatccatgtagttgaccccacttagtgggataaggcttg |
36101788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 37618175 - 37618216
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
37618175 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
37618216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 39906424 - 39906383
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
39906424 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
39906383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 40979980 - 40979939
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
40979980 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
40979939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 42187671 - 42187720
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggc-ttgttgttgt |
64 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
42187671 |
tttgatccatgtagccgaccccacttagtgggataaggctttgttgttgt |
42187720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 43281904 - 43281945
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
43281904 |
tttgatccatgtagccgaccccacttagtgggacaaggcttg |
43281945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 56
Target Start/End: Original strand, 17759499 - 17759543
Alignment:
| Q |
12 |
gttgtttgatccatgtagctgaccctacttagtgggaaaaggctt |
56 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
17759499 |
gttgtttgattcatgtagccgaccccacttagtgggataaggctt |
17759543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 56
Target Start/End: Original strand, 42969928 - 42969968
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt |
56 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
42969928 |
tttgatccatgtagccgaccccacttagtgggataaggctt |
42969968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 32)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 7133354 - 7133313
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7133354 |
tttgatccatgtagctgaccccacttagtgggaaaaggcttg |
7133313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 39525980 - 39526036
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
39525980 |
aatattatggcgtcgtttgatccatgtagctgaccctatttagtgggaccaggcttg |
39526036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 3 - 57
Target Start/End: Original strand, 41165499 - 41165553
Alignment:
| Q |
3 |
tattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||| |||| ||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
41165499 |
tattatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggcttg |
41165553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 4318897 - 4318856
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
4318897 |
tttgatccatgtagccgaccccacttagtgggaaaaggcttg |
4318856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 53
Target Start/End: Complemental strand, 9599446 - 9599409
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaagg |
53 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9599446 |
tttgatccatgtagctgaccttacttagtgggaaaagg |
9599409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 37311807 - 37311766
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
37311807 |
tttgatccatgtagccgaccccacttagtgggaaaaggcttg |
37311766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 57
Target Start/End: Original strand, 38869100 - 38869153
Alignment:
| Q |
4 |
attatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
38869100 |
attatggcgtcgtttgatccatgtagccgaccccacttagtgggaaaatgcttg |
38869153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 19908447 - 19908395
Alignment:
| Q |
5 |
ttatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||| |||| |||||||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
19908447 |
ttattgcgtagtttgatccatgtacctgaccccacttagtgggataaggcttg |
19908395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 56
Target Start/End: Complemental strand, 32082808 - 32082768
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt |
56 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
32082808 |
tttgatccatgtagccgaccccacttagtgggaaaaggctt |
32082768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 32404578 - 32404530
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttgttgttgt |
64 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||| |||||||| |
|
|
| T |
32404578 |
tttgatccatgtagccgaccccacttagtgggataaggctggttgttgt |
32404530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 57
Target Start/End: Complemental strand, 33560913 - 33560869
Alignment:
| Q |
13 |
ttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
33560913 |
ttgtttgatccatgtagccaaccctacttagtgggataaggcttg |
33560869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 56
Target Start/End: Complemental strand, 43598986 - 43598934
Alignment:
| Q |
4 |
attatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggctt |
56 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
43598986 |
attatggcgtagtttgatccatgtagcagaccctacttactgggataaggctt |
43598934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 7124370 - 7124417
Alignment:
| Q |
15 |
gtttgatccatgtagctgaccctacttagtgggaaaaggcttgttgtt |
62 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
7124370 |
gtttgatccatgtagctgacctcacttagtgggataagggttgttgtt |
7124417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 1210975 - 1211016
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
1210975 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
1211016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 2544823 - 2544864
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
2544823 |
tttgatccatgtagccgaccccacttagtggtaaaaggcttg |
2544864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 4001507 - 4001466
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
4001507 |
tttgatccatgtagccaaccccacttagtgggaaaaggcttg |
4001466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 22175375 - 22175416
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
22175375 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
22175416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 25979283 - 25979242
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
25979283 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
25979242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 27072539 - 27072498
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||||||||||| |
|
|
| T |
27072539 |
tttgatccatgtagccgaccatgcttagtgggaaaaggcttg |
27072498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 29577482 - 29577523
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
29577482 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
29577523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 30202182 - 30202141
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
30202182 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
30202141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 36339856 - 36339815
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
36339856 |
tttgatccatgtagctgactccacttagtgggaaaatgcttg |
36339815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 37462928 - 37462887
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
37462928 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
37462887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 41560459 - 41560500
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
41560459 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
41560500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 42539264 - 42539223
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
42539264 |
tttgatccatgtagacgaccccacttagtgggaaaaggcttg |
42539223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 43481850 - 43481809
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
43481850 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
43481809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 44941828 - 44941787
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
44941828 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
44941787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 49347445 - 49347404
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
49347445 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
49347404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 52532668 - 52532627
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
52532668 |
tttgattcatgtagccgaccccacttagtgggaaaaggcttg |
52532627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 52561641 - 52561600
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
52561641 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
52561600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 52921310 - 52921351
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
52921310 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
52921351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 25715393 - 25715337
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
25715393 |
aatattatggcgtaatttgatccatgtagccgacctcacttagtgggataaggcttg |
25715337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 31)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 45209272 - 45209216
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
45209272 |
aatattatggcgtagtttgatccatgtagccgaccccacttagtgggataaggcttg |
45209216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 15665331 - 15665372
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
15665331 |
tttgatccatgtagctgaccccacttagtgggataaggcttg |
15665372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 57
Target Start/End: Complemental strand, 22420781 - 22420728
Alignment:
| Q |
4 |
attatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||| ||||||||||||| |||||| |||||| ||||||||||| |||||||| |
|
|
| T |
22420781 |
attatggcgttgtttgatctatgtagttgaccccacttagtgggataaggcttg |
22420728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 23906349 - 23906308
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
23906349 |
tttgatccatgtagctgaccccacttagtgggataaggcttg |
23906308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 29399034 - 29399075
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
29399034 |
tttgattcatgtagctgaccccacttagtgggaaaaggcttg |
29399075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 51811330 - 51811283
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttgttgttgt |
64 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||||||||||| |
|
|
| T |
51811330 |
tttgatccatgtagccgaccc-acttagtgggataaggcttgttgttgt |
51811283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 4136801 - 4136766
Alignment:
| Q |
10 |
gcgttgtttgatccatgtagctgaccctacttagtg |
45 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4136801 |
gcgttgtttgatccatgtagccgaccctacttagtg |
4136766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 17900704 - 17900751
Alignment:
| Q |
10 |
gcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
17900704 |
gcgttgtttgattcatttagctgaccccacttagtgggataaggcttg |
17900751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Complemental strand, 19154921 - 19154874
Alignment:
| Q |
10 |
gcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
19154921 |
gcgttatttgatccatgcagctgaccccacttagtgggataaggcttg |
19154874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 15 - 65
Target Start/End: Complemental strand, 37042717 - 37042666
Alignment:
| Q |
15 |
gtttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgta |
65 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
37042717 |
gtttgatccatgtagccgacccgacttagtgggataaggcttggttgttgta |
37042666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 57
Target Start/End: Original strand, 38017317 - 38017360
Alignment:
| Q |
14 |
tgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
38017317 |
tgtttgatccatgtagccgatcctacttagtgggataaggcttg |
38017360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 47372936 - 47372975
Alignment:
| Q |
18 |
tgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
47372936 |
tgatccatgtagccgaccctacttagtgggataaggcttg |
47372975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 44719414 - 44719372
Alignment:
| Q |
15 |
gtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
44719414 |
gtttgatccatgtagccgaccctacttagtgggataagacttg |
44719372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 436459 - 436500
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
436459 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
436500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 7947167 - 7947208
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
7947167 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
7947208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 21528518 - 21528559
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
21528518 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
21528559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 27450232 - 27450191
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
27450232 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
27450191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 30634158 - 30634117
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
30634158 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
30634117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 31959866 - 31959825
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
31959866 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
31959825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 32479268 - 32479309
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
32479268 |
tttgatccatgtagccgaccccacttagtggaaaaaggcttg |
32479309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 36255574 - 36255533
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
36255574 |
tttgatccatgtggccgaccccacttagtgggaaaaggcttg |
36255533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 48174145 - 48174104
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
48174145 |
tttgatccatgtagcagaccccacttagtgggataaggcttg |
48174104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 57
Target Start/End: Complemental strand, 49738614 - 49738561
Alignment:
| Q |
4 |
attatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||| | ||||||||| |||||||| |
|
|
| T |
49738614 |
attatggcggtgtttgatccatgtagccgaccccatttagtgggataaggcttg |
49738561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 50238667 - 50238626
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
50238667 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
50238626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 50238753 - 50238712
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
50238753 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
50238712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 50862861 - 50862902
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
50862861 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
50862902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 51438675 - 51438716
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| |||||||| |
|
|
| T |
51438675 |
tttgatccatgtagctgacccaactttgtgggataaggcttg |
51438716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 52569567 - 52569526
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
52569567 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
52569526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 55007976 - 55008017
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
55007976 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
55008017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 56
Target Start/End: Original strand, 4441083 - 4441123
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt |
56 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
4441083 |
tttgatccatgtagccgaccccacttagtgggataaggctt |
4441123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 49686908 - 49686964
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||| |||||| ||||||||| ||||| ||||||||||| ||| |||| |
|
|
| T |
49686908 |
aatattatggcgtcgtttgaaccatgtagccgaccccacttagtgggataagacttg |
49686964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 18)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 49503635 - 49503579
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||| ||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
49503635 |
aatattatggcgtaatttgatccatgtagccgaccctacttagtgggataaggcttg |
49503579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 19676133 - 19676092
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
19676133 |
tttgatccatgtagctgaccccacttagtgggataaggcttg |
19676092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 41529991 - 41530043
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgtaat |
67 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
41529991 |
tttgatccatgtagccgaccccacttagtgggataaggcttggttgttgtaat |
41530043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 48734198 - 48734158
Alignment:
| Q |
17 |
ttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
48734198 |
ttgatccatgtagctgaccccacttagtgggataaggcttg |
48734158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 7446275 - 7446314
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggct |
55 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7446275 |
tttgatccatgtagctgactccacttagtgggaaaaggct |
7446314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 7454417 - 7454456
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggct |
55 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7454417 |
tttgatccatgtagctgactccacttagtgggaaaaggct |
7454456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 57
Target Start/End: Original strand, 52139025 - 52139071
Alignment:
| Q |
11 |
cgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
52139025 |
cgttatttgatccatgtagccgaccccacttagtgggataaggcttg |
52139071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 5169062 - 5169103
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
5169062 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
5169103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 12096757 - 12096716
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
12096757 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
12096716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 24778661 - 24778620
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
24778661 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
24778620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 29601122 - 29601163
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | |||||| |
|
|
| T |
29601122 |
tttgatccatgtagctgaccccacttagtgggatacggcttg |
29601163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 31566213 - 31566172
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
31566213 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
31566172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 53
Target Start/End: Complemental strand, 40273257 - 40273220
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaagg |
53 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
40273257 |
tttgatccatgtagccgaccccacttagtgggaaaagg |
40273220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 40672419 - 40672378
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
40672419 |
tttgatccatgtagctgacctcacttagtgggataaggcttg |
40672378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 42510068 - 42510027
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
42510068 |
tttgatccatgtagccgaccccacttagagggaaaaggcttg |
42510027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 45374525 - 45374488
Alignment:
| Q |
20 |
atccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
45374525 |
atccatgtagctgaccccacttagtgggataaggcttg |
45374488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 48508465 - 48508506
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
48508465 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
48508506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 52927900 - 52927859
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
52927900 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
52927859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 26)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8197608 - 8197552
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
8197608 |
aatattatggcgtcgtttgatccatgtagccgaccctacttagtgggataatgcttg |
8197552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 8202368 - 8202312
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
8202368 |
aatattatggcgtcgtttgatccatgtagccgaccctacttagtgggataatgcttg |
8202312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 3720467 - 3720420
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttgttgttg |
63 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
3720467 |
tttgatccatgtagccgaccccacttagtgggagaaggcttgttgttg |
3720420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 42092741 - 42092788
Alignment:
| Q |
10 |
gcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
42092741 |
gcgttgtttgatccatgtagctgaccctacttagtaggattaggcttg |
42092788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 3481384 - 3481425
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
3481384 |
tttgatccatgtagctgaccccacttagttggaaaaggcttg |
3481425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 57
Target Start/End: Complemental strand, 11992172 - 11992119
Alignment:
| Q |
4 |
attatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
11992172 |
attatggcgttatttgatccatgtagctgaccccacttagtggaataaggcttg |
11992119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 18959141 - 18959182
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
18959141 |
tttgatccatgtagctgaccccacttagtgggataaggcttg |
18959182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 12026079 - 12026032
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtggga |
48 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
12026079 |
aatattataacgtcgtttgatccatgtagctgaccccacttagtggga |
12026032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 227419 - 227460
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
227419 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
227460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 451700 - 451659
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
451700 |
tttgatccatgtagccgaccccacttagtgggacaaggcttg |
451659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 3635375 - 3635334
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
3635375 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
3635334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 4807825 - 4807866
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
4807825 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
4807866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 8181010 - 8181059
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgt |
64 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||| |||||||| |
|
|
| T |
8181010 |
tttgatccatgtagccgaccccacttagtgggataaggcttcgttgttgt |
8181059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 9531652 - 9531611
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
9531652 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
9531611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 12474979 - 12474938
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
12474979 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
12474938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 12520114 - 12520073
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
12520114 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
12520073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 17670698 - 17670739
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
17670698 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
17670739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 25834908 - 25834949
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
25834908 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
25834949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 28508908 - 28508949
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
28508908 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
28508949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 30306262 - 30306303
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
30306262 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
30306303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 35755297 - 35755256
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
35755297 |
tttgatccatgcagccgaccctacttagtgggataaggcttg |
35755256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 38328422 - 38328381
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
38328422 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
38328381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 41763095 - 41763054
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
41763095 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
41763054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 43573182 - 43573141
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
43573182 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
43573141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 10516816 - 10516760
Alignment:
| Q |
1 |
aatattatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| | ||||||||||| |||||||| |
|
|
| T |
10516816 |
aatattatggcgtaatttgatccatgtagctgatctcacttagtgggataaggcttg |
10516760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 38430114 - 38430162
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttgttgttgt |
64 |
Q |
| |
|
||||||||||||||| ||||| |||||||| || |||||||| |||||| |
|
|
| T |
38430114 |
tttgatccatgtagccgaccccacttagtgagataaggcttggtgttgt |
38430162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 65
Target Start/End: Original strand, 21089615 - 21089677
Alignment:
| Q |
4 |
attatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgta |
65 |
Q |
| |
|
||||| || |||||||||||||||||||| ||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
21089615 |
attatggcattgtttgatccatgtagctgcccccacttagtgggataaggcttggttgttgta |
21089677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 34557 - 34516
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| |||| |
|
|
| T |
34557 |
tttgatccatgtagctgaccccacttagtgggataagacttg |
34516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 608391 - 608432
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
608391 |
tttgatccatgtagccgaccctacttagtgggataagacttg |
608432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 9707000 - 9707041
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
9707000 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
9707041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 12890805 - 12890846
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
12890805 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
12890846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 28085606 - 28085647
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
28085606 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
28085647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 30789126 - 30789085
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
30789126 |
tttgatccatgtagccgatcctacttagtgggataaggcttg |
30789085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 34934882 - 34934841
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
34934882 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
34934841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 56
Target Start/End: Original strand, 8364786 - 8364826
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt |
56 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
8364786 |
tttgatccatgtagccgaccccgcttagtgggaaaaggctt |
8364826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 24)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 57
Target Start/End: Complemental strand, 15588454 - 15588401
Alignment:
| Q |
4 |
attatcgcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||| |||| |||||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
15588454 |
attatggcgtcgtttgatctatgtagccgaccctacttagtgggataaggcttg |
15588401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 53
Target Start/End: Original strand, 38830550 - 38830586
Alignment:
| Q |
17 |
ttgatccatgtagctgaccctacttagtgggaaaagg |
53 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38830550 |
ttgatccatgtagctgaccccacttagtgggaaaagg |
38830586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 13561438 - 13561395
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttgtt |
59 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
13561438 |
tttgatccatgtagccgaccccacttagtgggataaggcttgtt |
13561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 28411900 - 28411947
Alignment:
| Q |
10 |
gcgttgtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
28411900 |
gcgttgtttgattcatgtagccgaccccacttagtgggataaggcttg |
28411947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 42272707 - 42272746
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggct |
55 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
42272707 |
tttgatccatgtagctgaccccacttagtgggataaggct |
42272746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 57
Target Start/End: Original strand, 2645219 - 2645261
Alignment:
| Q |
15 |
gtttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
2645219 |
gtttgatccatgtagccggccctacttagtgggataaggcttg |
2645261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 79747 - 79784
Alignment:
| Q |
20 |
atccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
79747 |
atccatgtagctggccccacttagtgggaaaaggcttg |
79784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 408546 - 408505
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
408546 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
408505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 2915548 - 2915507
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
2915548 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
2915507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 3302074 - 3302115
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
3302074 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
3302115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 4496614 - 4496655
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
4496614 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
4496655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 5558371 - 5558412
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
5558371 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
5558412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 5860064 - 5860105
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
5860064 |
tttgatctatgtagccgaccctacttagtgggataaggcttg |
5860105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 7359313 - 7359272
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| |||| |
|
|
| T |
7359313 |
tttgatccatgtagctgaccccacttagtgggacaagacttg |
7359272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 11002476 - 11002423
Alignment:
| Q |
13 |
ttgtttgatccatgtagctgaccctacttagtgggaaaaggctt-gttgttgta |
65 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
11002476 |
ttgtttgattcatgtagtcgaccctacttagtgggataaggcttggttgttgta |
11002423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 16347432 - 16347391
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
16347432 |
tttgatccatgtagccgaccctacttagtgggataagacttg |
16347391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 20457003 - 20457044
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
20457003 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
20457044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 28985313 - 28985354
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
28985313 |
tttgatccatgtagccgaccccacttagtgggacaaggcttg |
28985354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 29816612 - 29816653
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
29816612 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
29816653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 30213805 - 30213846
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
30213805 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
30213846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 38685197 - 38685238
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
38685197 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
38685238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 42576240 - 42576281
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
42576240 |
tttgatccatgtagccgacccgacttagtgggataaggcttg |
42576281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 219512 - 219480
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtggga |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
219512 |
tttgatccatgtagctgaccctatttagtggga |
219480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 1287630 - 1287590
Alignment:
| Q |
17 |
ttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
1287630 |
ttgatccatgtagccgaccccacttagtgggataaggcttg |
1287590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1318 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold1318
Description:
Target: scaffold1318; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 561 - 602
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
561 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0570 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0570
Description:
Target: scaffold0570; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 1000 - 959
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||| |
|
|
| T |
1000 |
tttgatccatgtagctgaccccatttagtgggataaggcttg |
959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 28941 - 28900
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
28941 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
28900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 57
Target Start/End: Original strand, 31698 - 31739
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggcttg |
57 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
31698 |
tttgatccatgtagccgaccccacttagtgggataaggcttg |
31739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 56
Target Start/End: Complemental strand, 58278 - 58238
Alignment:
| Q |
16 |
tttgatccatgtagctgaccctacttagtgggaaaaggctt |
56 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
58278 |
tttgatccatgtagccgacccaacttagtgggataaggctt |
58238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University