View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_274 (Length: 258)
Name: NF11386A_low_274
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_274 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 5337446 - 5337696
Alignment:
| Q |
1 |
atttacaatactccatgctttatgctaattcaggttcaaaatcagattccaatcttcaagtttaaacattctgctattcatcaatcaatatactccaacg |
100 |
Q |
| |
|
|||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337446 |
atttacaatactccatcctttattcaaattcaggttcaaaatcagattccaatcttcaagtttaaacattctgctattcatcaatcaatatactccaacg |
5337545 |
T |
|
| Q |
101 |
gtggcagattggaaaggttagtttcgttgacttcagcttatttactgtaac-nnnnnnncttcaagtttttcgctgacgctgattttaatattaaaatta |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5337546 |
gtggcagatgggaaaggttagtttcgttgacttcagcttatttactgtaacttttttttcttcaagtttttcgctgacgctgattttaatattaaaatta |
5337645 |
T |
|
| Q |
200 |
gaaaaacgacgaacctgctgcttcttcttcatcatcttctgcttctatggt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5337646 |
gaaaaacgacgaacctgctgcttcttcttcatcatcttctgcttctgtggt |
5337696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University