View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_294 (Length: 252)
Name: NF11386A_low_294
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_294 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 252
Target Start/End: Original strand, 42601595 - 42601828
Alignment:
| Q |
20 |
attttgtcacaatgtatcaaattagtttctcacattatgtacatttcaaaatgattcattaaattgcaattaaattcacccatccgtttaacattaagtt |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42601595 |
attttgtcacattgtatcaaattagtttctcacattatgtacatttcaaaatgattcattaaattgcaattaaattcacccatccgtttaacattaagtt |
42601694 |
T |
|
| Q |
120 |
ggtaatttctgagatgtatct-aaattattatgtaaacgagatgcatttgatagcaaaataaaaagttgttgctgtttttcactcaaacttccaatccaa |
218 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
42601695 |
ggtaatttctgagatgtatttgaaattattatgtaaacgagatgcatttgatagcaaaataaaaagatgttgctgtttttcactcaaactcccaatccaa |
42601794 |
T |
|
| Q |
219 |
acccttccaagtctctgtatttctctcagctttg |
252 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
42601795 |
acccttccaagtttctgtatttctctcagctttg |
42601828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University