View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_296 (Length: 251)
Name: NF11386A_low_296
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_296 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 94 - 238
Target Start/End: Complemental strand, 5035344 - 5035200
Alignment:
| Q |
94 |
attcaacaaaaactcaagaaaattaagcatattttttatacatgaaacaaaaatttatatattgatcatatattgctttattgcattattatgtcgcttc |
193 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5035344 |
attcaacaaaaactcaacaaaattaagcatattttttatacatgaaacaaaaatttatatattgatcatatattgctttattgcattattatgttgcttc |
5035245 |
T |
|
| Q |
194 |
cattccaaagacattaatttttgggtttatgctgagtgtagatat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035244 |
cattccaaagacattaatttttgggtttatgctgagtgtagatat |
5035200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 5035435 - 5035401
Alignment:
| Q |
1 |
aaagctttcttcacccttaggttgaaacttgaaac |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035435 |
aaagctttcttcacccttaggttgaaacttgaaac |
5035401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University