View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_307 (Length: 250)
Name: NF11386A_low_307
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_307 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 105 - 235
Target Start/End: Original strand, 25615311 - 25615441
Alignment:
| Q |
105 |
tttcaatgagatacattgcttaatatgttttagcttcgatatagaatcnnnnnnngtcaactgaattgaaatttttgttctcaatgtattacataaattc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25615311 |
tttcaatgagatacattgcttaatatgttttagcttcgatatagaatctttttttgtcaactgaattgaaatttttgttctcaatgtattacataaattc |
25615410 |
T |
|
| Q |
205 |
tttctatgttcgatgtccttgaatttgtaat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25615411 |
tttctatgttcgatgtccttgaatttgtaat |
25615441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 26 - 105
Target Start/End: Original strand, 24992893 - 24992972
Alignment:
| Q |
26 |
atcagaagctcaagcggagatcaaagcccggaaactttgaatgactttgagaaaagacagttgaagaggtcacctctgat |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24992893 |
atcagaagctcaagcggagatcatagcccgaaaactttgaatgacttagagaaaagacagttgaagaggtcacctctgat |
24992972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University