View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_312 (Length: 250)
Name: NF11386A_low_312
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_312 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 21 - 237
Target Start/End: Complemental strand, 50386462 - 50386246
Alignment:
| Q |
21 |
aatattgtccatatctaatggatacaactctttggttttcaagattcttgtgtagaaggaaattgcttggtctatacttatcttgtcaattttgacatcc |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50386462 |
aataatgtccatatctaatggatacaactctttggttttcaagattcttgtgtagaaggaaattgcttggtctatacttatcttgtcaattttgacatcc |
50386363 |
T |
 |
| Q |
121 |
ttcttagaaatgtggtttgttgggaaactagttggtggatggagaaatatgatgagtgaggtgagattgaaatagttgcatttgttggtgaataggtttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50386362 |
ttcttagaaatgtggtttgttgggaaactagttggtggatggagaaatatgatgagtgaggtgaaattgaaatagttgcatttgttggtgaataggtttt |
50386263 |
T |
 |
| Q |
221 |
tagaggcattgttattc |
237 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
50386262 |
tagaggcattgttattc |
50386246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University