View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_313 (Length: 250)
Name: NF11386A_low_313
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_313 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 31141873 - 31141645
Alignment:
| Q |
13 |
tgactactttttattgtaacattctgagagatttggcggaacagaaacaaaggcatatttcaaaatgttaggaaagatattcatgcttcaactaataaag |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31141873 |
tgactactttttattgtaacattctgatagatttggcggaacagaaacaaagacatatttcaaaatgttaggaaagatattcatgcttcaactaataaag |
31141774 |
T |
 |
| Q |
113 |
ttccctcttatcactcttgtatgatatgctcttgatcgtatatataacaaatgggcatttcaccatcttccttgatgccccatgcaaaaggttatataaa |
212 |
Q |
| |
|
||| ||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31141773 |
ttctctcttatcactcttgtacggtatgctcttgatcgtatagataacaaatgggcatttcaccatcttccttgatgccccatgcaaaaggttatataaa |
31141674 |
T |
 |
| Q |
213 |
agtatgttacaacgggacgcgagaataat |
241 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
31141673 |
agtatgttacaacgggaagcgagaataat |
31141645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University