View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_322 (Length: 249)
Name: NF11386A_low_322
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_322 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 24130127 - 24130246
Alignment:
| Q |
1 |
aatatatcaaagaaataaaaattagatttcaaggacaaatactgtcattgtaaatcaactatacac-taaattcaatgaaagtgtgtcattttacggcat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
24130127 |
aatatatcaaagaaataaaaattagatttcaaggacaaatactgtcattgtaaatcaactttacacttaaatccaatgaaagtgtgtcgttttacggcat |
24130226 |
T |
|
| Q |
100 |
caccttactttcgtaactta |
119 |
Q |
| |
|
| ||||||||| |||||||| |
|
|
| T |
24130227 |
cgccttacttttgtaactta |
24130246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 116 - 212
Target Start/End: Original strand, 24130882 - 24130978
Alignment:
| Q |
116 |
cttataagcaaggtcccgtatgtacaactgaaatactaagtgcatggacattagatacatgttggggagttcatgggtcaagcgaaaaacaacacaa |
212 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24130882 |
cttataaacaaggtcccgtaagtacaactgaaatactaagtgcatggacattagatacatgttggggagttcatgggtcaagcgacaaacaacacaa |
24130978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University