View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_343 (Length: 246)
Name: NF11386A_low_343
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_343 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 213
Target Start/End: Complemental strand, 23332795 - 23332595
Alignment:
| Q |
13 |
tgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332795 |
tgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcga |
23332696 |
T |
|
| Q |
113 |
aatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccacata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
23332695 |
aatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccatata |
23332596 |
T |
|
| Q |
213 |
t |
213 |
Q |
| |
|
| |
|
|
| T |
23332595 |
t |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 246
Target Start/End: Complemental strand, 23322373 - 23322335
Alignment:
| Q |
208 |
acatatgcgtttggattttacaacgattgtgtttggtga |
246 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtga |
23322335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 246
Target Start/End: Complemental strand, 23332540 - 23332502
Alignment:
| Q |
208 |
acatatgcgtttggattttacaacgattgtgtttggtga |
246 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtga |
23332502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University