View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_346 (Length: 245)
Name: NF11386A_low_346
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_346 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 245
Target Start/End: Complemental strand, 33042402 - 33042178
Alignment:
| Q |
22 |
ggtaagaagttaaaactatcagattttgatcttgaatttggttcatgacagaacctcattaatcatataacnnnnnnnn-cccctttcatccaagtgacc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33042402 |
ggtaagaagttaaaactatcagattttgatcttgaatttggttcatgaccgaacctcattaatcatataactttttttttcccctttcatccaagtgacc |
33042303 |
T |
|
| Q |
121 |
ttgtgcaataaagtaaggtagtaaataagacgaacccccaaacaagagtaaataagacgacaaatccttgttcgtaagacccacgtctacacactaccaa |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33042302 |
ttgtgtaataaagtaaggtagtaaataagacgaacccccaaacaatagtaaataagacgacaaatccttgttcgtaagacccacgtccacacactaccaa |
33042203 |
T |
|
| Q |
221 |
caacaacactttgtgaacctcgaca |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33042202 |
caacaacactttgtgaacctcgaca |
33042178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University