View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_347 (Length: 245)
Name: NF11386A_low_347
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_347 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 11527527 - 11527321
Alignment:
| Q |
22 |
tgttttcttctgttctttctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11527527 |
tgttttcttctgttctttctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttatt |
11527428 |
T |
|
| Q |
122 |
ttatacatgtataatgtaggaacgaaatatgtggacgcgtgtctgcaaatttgaaagagaaacagttcttttaagtttcaatatacagtgccctggttat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11527427 |
ttatacatgtataatgtaggaacgaaatatgtggatgcgtgtctgcaaatttgaaagagaaacagttctttcaagtttcaatatacagtgccctggttat |
11527328 |
T |
|
| Q |
222 |
aatattg |
228 |
Q |
| |
|
||||||| |
|
|
| T |
11527327 |
aatattg |
11527321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University