View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_354 (Length: 245)
Name: NF11386A_low_354
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_354 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 3 - 245
Target Start/End: Complemental strand, 23333840 - 23333598
Alignment:
| Q |
3 |
acgaagttgaccgataaaattgtgtgccagaatgcagctgaagcagtactcccccaaagaggttgataagtttgttttatgtaattttttgctgttttga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333840 |
acgaagttgaccgataaaattgtgtgccggaatgcagctgaagcagtactccccccaagaggttgataagtttgttttatgtaattttttgctgttttga |
23333741 |
T |
|
| Q |
103 |
tatattgtgtcatgatttaccaggaaaaatgtacacattgtcgttacctcaggaactgttgttcgtgttgctgatgagctttcccttcaagagatgcgat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333740 |
tatattgtgtcatgatttaccaggaaaaatgtacacattgtcgttgcctcaggaactgttgttcgtgttgctgatgagctttcccttcaagagatgcgat |
23333641 |
T |
|
| Q |
203 |
tgctgaatacatattatgcagagcttgagaccgcaactgtaag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333640 |
tgctgaatacatattatgcagagcttgagaccgcaactgtaag |
23333598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University