View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_370 (Length: 242)
Name: NF11386A_low_370
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_370 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 9 - 153
Target Start/End: Original strand, 4377325 - 4377469
Alignment:
| Q |
9 |
agactgcataacagtgatcctgtacttccacgttgtgaggttattgtgtgatttactgaccctgaaaaatggtccgttgtaagagtttctgttggcttat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4377325 |
agactgcataacagtgatcctgtacttccacgttgtgaggttattgtgtgatttactgaccctgaaaaatggtccgttgtaagagtttctgttggcttat |
4377424 |
T |
|
| Q |
109 |
cagtggaaacttcaatgcgtactgttttcagtatatagtgtgatt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4377425 |
cagtggaaacttcaatgcgtactgttttcagtatatagtgtgatt |
4377469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 4377498 - 4377554
Alignment:
| Q |
182 |
tgtgttttacatcatgtatgagttgtaacatgtctgtaaatgctgagtgtatattat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4377498 |
tgtgttttacatcatgtatgagttgtaacatgtctgtaaatgctgagtgtatattat |
4377554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University