View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_371 (Length: 242)
Name: NF11386A_low_371
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_371 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 3 - 242
Target Start/End: Complemental strand, 48484629 - 48484390
Alignment:
| Q |
3 |
tgaagtagcaaagatatagtcctgtagtgttgtgtgtaccgtgtcttcatatctccataatacttctgcgcttctttctcatttttgaaataacaaaaca |
102 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484629 |
tgaagtatcaaagatatagtcctgcagtgttgtgtgtaccgtgtcttcatatctccataatatttctgcgcttctttctcatttttgaaataacaaaaca |
48484530 |
T |
 |
| Q |
103 |
aatttcttcagatcacggaacacaatccccaagctggaattcccatgaagttaaatcagaaacaggtgttttcctttttgcaaggtaagcatgcatttca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484529 |
aatttcttcagatcacggaacacaatccccaagctggaattcccatgaagttaaatcagaaacaggtgttttcctttttgcaaggtaagcatgcatttca |
48484430 |
T |
 |
| Q |
203 |
tatgaacttttacatactgaaacttccatttactgtacat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48484429 |
tatgaacttttacatactgaaacttccatttcttgtacat |
48484390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University