View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_375 (Length: 241)
Name: NF11386A_low_375
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_375 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 71 - 221
Target Start/End: Original strand, 43665221 - 43665370
Alignment:
| Q |
71 |
gaaatgattaatactatgtttgaaatcacagtaggtgccccagctaaaagttggccattcaaagcatgaatttctaacttcctaaccataatgtcgaaaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665221 |
gaaatgattaatactatgtttgaaatcacagtaggtgccccagctaaaagttggccattcaaagcatgaatttctaacttcctaaccataatgtcgaaaa |
43665320 |
T |
|
| Q |
171 |
ggcactcctagaatgtgagagttaattgcccaacacgtaaccaatagcatg |
221 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43665321 |
ggcactactagaatgtgaga-ttaattgcccaacacgtaaccaatagcatg |
43665370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 51
Target Start/End: Original strand, 43665162 - 43665194
Alignment:
| Q |
19 |
aaaattatcgtgaaccaatgatttctcatttac |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43665162 |
aaaattatcgtgaaccaatgatttctcatttac |
43665194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University