View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_403 (Length: 237)
Name: NF11386A_low_403
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_403 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 36970860 - 36971096
Alignment:
| Q |
1 |
agcatagttgtcaaaccctaacgaacacagagcccaacagatatcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36970860 |
agcatagttgtcaaaccctaacgaacacagagcccaacagatatcgtccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacct |
36970959 |
T |
 |
| Q |
101 |
gtcacgaaacttatgaactctgtcgcacattcttgcatcaactgtttgctttcttttgagatctttgcattgggaggaagattttgcttcattattctac |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36970960 |
gtcacgaaacttatgaattctgtcgcacattcttgcatcaactgtttgctttcttttgagatctttgcattgggaggaagattttgcttcattattctac |
36971059 |
T |
 |
| Q |
201 |
ccacattcgctatgggcaacgttttatctccttcatc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36971060 |
ccacattcgctatgggcaacgttttatctccctcatc |
36971096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 31 - 99
Target Start/End: Original strand, 39786313 - 39786381
Alignment:
| Q |
31 |
agcccaacagatatcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacc |
99 |
Q |
| |
|
||||||||| | |||||| ||||| || |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39786313 |
agcccaacaaacatcatcaccattcactgtcttgcgcttctccttgtgacacttgtcagatgcttcacc |
39786381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 139
Target Start/End: Complemental strand, 56068049 - 56067978
Alignment:
| Q |
68 |
ttctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaactctgtcgcacattcttgcatc |
139 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||| | ||| ||||||||||||| |||| ||||||||| |
|
|
| T |
56068049 |
ttctctttctgacacttttcagatgcttcacctgttatgaagcttatgaactctgatacacactcttgcatc |
56067978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University