View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_405 (Length: 237)
Name: NF11386A_low_405
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_405 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 21 - 219
Target Start/End: Original strand, 38092931 - 38093125
Alignment:
| Q |
21 |
aacaaagcatgcagaattgactcaaagggtgcagaaggaaagaaaccctatatgttgttttcttgaatgagaaatattgg-aaaaaggaaacaatgggat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38092931 |
aacaaagcatgcagaattgactcaaagggtgca-----caagaaaccctatatgttgttttcttgaatgagaaatattggaaaaaaggaaacaatgggat |
38093025 |
T |
 |
| Q |
120 |
tccttcggacaatttgatacgtctatgagaacaagatcttcattcaaattgtgggatccaggaatatttgttcttgttgcaaaatttccttgaatatatt |
219 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38093026 |
tccttcggacaattcgatacgtctatgagaacaagatcttcattcaaattgtgggatccacgaatatttgttctagttgcaaaatttccttgaatatatt |
38093125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University