View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_407 (Length: 237)
Name: NF11386A_low_407
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_407 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 226
Target Start/End: Original strand, 21491466 - 21491671
Alignment:
| Q |
21 |
ataattcatagctcaaaagaaaaccattgtcttgcatatttagaatgacaacaaatttgaccaaatcacagtgacacggtaactcggacaaacttaccgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21491466 |
ataattcatagctcaaaagaaaaccattgtcttgcatatttagaatgacaacaaatttgaccaaatcacagtgacacggtaactcggacaaacttaccgt |
21491565 |
T |
 |
| Q |
121 |
taatccaaacatacacgcaaaattaacatagtttatgagacacattaccaattaattaaagctatgaaactaaacgtaaaactagactcaattatttatt |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21491566 |
taatccaaacatacatgcaaaattaacatagtttatgagacacattaccaattaattaaagctatgaaactaaatataaaactagactcaattatttatt |
21491665 |
T |
 |
| Q |
221 |
ttcttc |
226 |
Q |
| |
|
|||||| |
|
|
| T |
21491666 |
ttcttc |
21491671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University