View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_417 (Length: 234)
Name: NF11386A_low_417
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_417 |
 | |
|
| [»] scaffold1030 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold1030 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: scaffold1030
Description:
Target: scaffold1030; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 35 - 153
Target Start/End: Original strand, 2018 - 2136
Alignment:
| Q |
35 |
ggtgtttatttggtctcatttgtgagaagagaacattaggtgctactataggtgttttggttggttttaattgtttcttaaaaggtttttggtacgaata |
134 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
2018 |
ggtgtttatttggtctcatttgtgcgaagagaacattaggtgctactataggtgttttggttggttttaattgtttttttaaaggtttttggtacaaata |
2117 |
T |
|
| Q |
135 |
gcatatgataggtgtttag |
153 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2118 |
gcatatgataggtgtttag |
2136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1030; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 149 - 232
Target Start/End: Original strand, 2252 - 2335
Alignment:
| Q |
149 |
tttagtggtgtggtgatgtaggagatgtaagggttttctgtgcttattttactatatatgttctttttgtttttcaggtctatg |
232 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2252 |
tttagtggtgtcgtgatgtaggagatgtaagggttttctgtgcgtattttactatatatgttctttttgttttccaggtctatg |
2335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 35 - 153
Target Start/End: Complemental strand, 14279519 - 14279400
Alignment:
| Q |
35 |
ggtgtttatttggtctcatttgtgagaagagaacattaggtgctactataggtgttttggttggttttaattg-tttcttaaaaggtttttggtacgaat |
133 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||| ||| || ||||||||||| ||||||| |
|
|
| T |
14279519 |
ggtgtttatttggtctcatttgtgcgaagagaacattaggtgctagtataggtgttttggtcggttttaattgttttttttaaaggtttttgatacgaat |
14279420 |
T |
|
| Q |
134 |
agcatatgataggtgtttag |
153 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
14279419 |
agcatatgatagctgtttag |
14279400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 152 - 203
Target Start/End: Complemental strand, 14279281 - 14279230
Alignment:
| Q |
152 |
agtggtgtggtgatgtaggagatgtaagggttttctgtgcttattttactat |
203 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
14279281 |
agtggtgtgttgatgtatgagatgtaagggttttctgtgcgtattttactat |
14279230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University