View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_421 (Length: 233)
Name: NF11386A_low_421
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_421 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 39495413 - 39495614
Alignment:
| Q |
17 |
atacgatgacaaacataacaacttatgtaattatcagttactaatactattaacactgcataatagcttacc--aatatactctacacaatgcctgtatt |
114 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39495413 |
atacgatgactaacataacaacttatgtaattatcagttactaatactattcacactgcataatagcttaccccaatatactctacacaatgcctgtatt |
39495512 |
T |
|
| Q |
115 |
cacaaatcataagcactaaaccatgaagttaaattcataaaacattagtagtgtaccatcaccctgctatataatatgcattaatctattttctactctc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495513 |
cacaaatcataagcactaaaccatgaagttaaattcataaaacattagtagtgtaccatcaccctgctatataatatgcattaatctattttctactctc |
39495612 |
T |
|
| Q |
215 |
tg |
216 |
Q |
| |
|
|| |
|
|
| T |
39495613 |
tg |
39495614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University