View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_434 (Length: 230)
Name: NF11386A_low_434
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_434 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 42 - 224
Target Start/End: Complemental strand, 28032727 - 28032545
Alignment:
| Q |
42 |
ggttgttgccacttctttggttgctcctctccattagttatgacgtcggttgattttgtttatcatcaaattaattttgtaataagcttaaagctcaact |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
28032727 |
ggttgttgccacttctttggttgctcctctccattagttatgacgtcagttggttttgtttatcatcaaattaattttgtaacaagcttaaaactcaaca |
28032628 |
T |
|
| Q |
142 |
tgaggggtattattttgagtttatattattgagtgtattttttctttcttcagggaatggcataacaagaagaaacatgtact |
224 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28032627 |
tgagggatattattttgagtttatattattgagtgtattttttctttcttcagggaatggcataacaagaagaaacatgtact |
28032545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 3 - 49
Target Start/End: Complemental strand, 28032784 - 28032738
Alignment:
| Q |
3 |
gttcgattatgattcagtttgatattatttcctcgcttcggttgttg |
49 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
28032784 |
gttcgactatgatttagtttgatattatttcctcgtttcggttgttg |
28032738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University