View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_44 (Length: 421)
Name: NF11386A_low_44
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 8 - 415
Target Start/End: Original strand, 42484854 - 42485261
Alignment:
| Q |
8 |
tggtgttctatttggcccgttctcacaatccgtttcgggaattttaattggaagctctactctcgccttcgcaagattagatggagatgtctacattgct |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42484854 |
tggtcttctatttggcccgttctcacaatccgtttcaggaattgtaattggaagctctactctcgccttcgcgagattagatggagatgtctacattgct |
42484953 |
T |
|
| Q |
108 |
attataaatgggcctggaccaatacccgggcccattcctgcacgacgggcaattattggtgatgttgttaataacggagtattagtagaatttgccggct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484954 |
attataaatgggcctggaccaatacccgggcccattcctgcacgacgggcaattattggtgatgttgttaataacggagtattagtagaatttgccggct |
42485053 |
T |
|
| Q |
208 |
ctagtcgatggtgggttggtttatatgctggccatgcaggcggggcttttcaaatatgggacgcgcacacggaacagcgcgtgttcgttggcggttcatt |
307 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42485054 |
ctagtcgttggtgggttggtttatatgctggccatgcaggcggggcttttcaaatatgggacgcgcacacggaacagcgcgtgttcgttggcggttcatt |
42485153 |
T |
|
| Q |
308 |
aaccgatccagaaacagttcaaggatggcatatgttaaccgaattagttgaaccggtcggtcgagtccgagtcactgaaagaggatttgtagtagcttgc |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
42485154 |
aaccgatccagaaacagttcaaggatggcatatgttaaccgaattagttgaaccggtcggtcgagtccgagtcaccgaaagagaatttgtagtagcttgc |
42485253 |
T |
|
| Q |
408 |
acaagtac |
415 |
Q |
| |
|
|||||||| |
|
|
| T |
42485254 |
acaagtac |
42485261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University