View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_441 (Length: 230)
Name: NF11386A_low_441
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_441 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 11332034 - 11332258
Alignment:
| Q |
1 |
atcagatatgtctaaatgcatgatgatatagaattgaacacagaaaattcaacataattgcaacttgcagtagaagttagcaataataccttcatcctag |
100 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11332034 |
atcagatatgtctaaatgcatggtgacatagaattgaacacagaaaattcaacataattgcaacttgcagtagaagttagcaataataccttcatcctag |
11332133 |
T |
|
| Q |
101 |
gccgtttttcagcattcaatttgcgaacttcataacggatcctcttagcaaagagtctgctttgcctcttttctttgtatctcaacaaacttgcctctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11332134 |
gccgtttttcagcattcaatttgcgaacttcataacggatcctcttagcaaagagtctgctttgcctcttttctttgtatctcaacaaacttgcctctct |
11332233 |
T |
|
| Q |
201 |
ctgcccaagcttccaacccatttct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
11332234 |
ctgcccaagcttccaacccatttct |
11332258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University