View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_455 (Length: 230)
Name: NF11386A_low_455
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_455 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 29 - 224
Target Start/End: Complemental strand, 31434484 - 31434289
Alignment:
| Q |
29 |
tatggaaggaagaactagaatgaaacggcggtgatacttcaccgggtccggaatgaagaaatgctatcacccctttaacagcaattatatctaaaaagtg |
128 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
31434484 |
tatggaaggaagaactagaatgaaacgtcggtgttacttcaccgggtccggaatgaagaaatactatcacccctttaacaacaattatatctaaaaggtg |
31434385 |
T |
|
| Q |
129 |
ttgttaaaaaacagagtctttatttaagatgttagtaacattttacaacactttactgtaaaagagctttcatatgtttcacctttgacagcatca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31434384 |
ttgttaaaaaacagagtctttatttaagatgttagtaacattttacaacactttactgtaaaagagctttcatatgtttcacctttgacagcatca |
31434289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University