View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_471 (Length: 229)
Name: NF11386A_low_471
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_471 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 55 - 211
Target Start/End: Complemental strand, 26793648 - 26793490
Alignment:
| Q |
55 |
ataggtttttgaaaggctaggcctagtggaacttagttttagcttttgttaattaaagt--agtcgagaaatcaagtgcgcttaaacnnnnnnnattgaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
26793648 |
ataggtttttgaaaggctaggcctagtggaacttagttttagcttttgttaattaaagtgtagtcgagaaatcaagtgcgcttaaactttttttattgaa |
26793549 |
T |
 |
| Q |
153 |
aagaaaagaagcattagtaaacgaatacttcaaggtacacattaatctgaggaatatat |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26793548 |
aagaaaagaagcattagaaaacgaatacttcaaggtacacattaatctgaggaatatat |
26793490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University