View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_480 (Length: 228)
Name: NF11386A_low_480
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_480 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 45596515 - 45596585
Alignment:
| Q |
1 |
gaagtttcttaatgatttttatatcatcagcaagagaactaataatcctcttttcatcaaagatgtctgag |
71 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
45596515 |
gaagtttgttaatgatttttatatcatcagcaagagaactaataaacctcttttcgtcaaagatgtctgag |
45596585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 162 - 222
Target Start/End: Original strand, 45596664 - 45596724
Alignment:
| Q |
162 |
ataaacctcgagaattaaaataaaaaattcctactatcttgccaaaatgactttttatcaa |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45596664 |
ataaaccttgagaattaaaataaaaaatacctactatcttgccaaaatgactttttatcaa |
45596724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University