View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_491 (Length: 225)
Name: NF11386A_low_491
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_491 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 225
Target Start/End: Original strand, 34570946 - 34571151
Alignment:
| Q |
20 |
aacatcctggtcaaatggaccgtcaaaatcaaaaacttccacatacaaaactgatggtggttcttccatagcatcaaactctaatatctctgcatattag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570946 |
aacatcctggtcaaatggaccgtcaaaatcaaaaacttccacatacaaaactgatggtggttcttccatagcatcaaactctaatatctctgcatattag |
34571045 |
T |
 |
| Q |
120 |
tatataaaaccaatacagaatataagtaaataaacattcaaattgaaacaannnnnnnagcaattaagtggcaagtcagaaggacaaaccattccattga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571046 |
tatataaaaccaatacagaatataagtaaagaaacattcaaattgaaacaatttttttagcaattaagtggcaagtcagaaggacaaaccattccattga |
34571145 |
T |
 |
| Q |
220 |
ggatct |
225 |
Q |
| |
|
|||||| |
|
|
| T |
34571146 |
ggatct |
34571151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University