View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_492 (Length: 225)
Name: NF11386A_low_492
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_492 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 37 - 219
Target Start/End: Original strand, 37566782 - 37566966
Alignment:
| Q |
37 |
taaactcctcatggtattagtgttacattttttactctaaattcagtgttttaaaaactgaaccgaat--cgaatcagtgggactttttatcgtggttca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37566782 |
taaactcctcatggtattagtgttacattttttactctaaattcagtgttttaaaaactgaaccgaatatcgaatcagtgggactttttatcgtggttca |
37566881 |
T |
|
| Q |
135 |
acctctttaaaccgtctagtttgtttcgggttttaaaacattgttgaaaacaagcagaggaattaaggatatattaccatgttaa |
219 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37566882 |
acctctttaaaccgtctagtttgattcgggttttaaaagattgttgaaaacaagcagaggaattaaggatatattaccatgttaa |
37566966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University