View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_494 (Length: 225)
Name: NF11386A_low_494
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_494 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 8847293 - 8847075
Alignment:
| Q |
1 |
actgaattatgtaatttgcttcatagtttgcacacaaatttagttgatgctaataaattatacaggaaataatgtacaatatgatgcttataatgcaaca |
100 |
Q |
| |
|
|||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8847293 |
actgaattatgtgatttgcttcgtagtta-cacacaaatttagttgatgctaataaattatacaggaaataatgtacaatatgatgcttataatgcaaca |
8847195 |
T |
 |
| Q |
101 |
acaattcatagagaatagaacaacatgcaaat-ttgtatcggtacttgatgaagatgtctacttgaagaattccataacccaaaaaccagagagatagca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8847194 |
acaattcatagagaatagaacaacatgcaaatgttgtattggtacttgatgaagatgtctacttgaagaattccacaacccaaaaaccagagagatagca |
8847095 |
T |
 |
| Q |
200 |
tgcaaatttgatgccactaa |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8847094 |
tgcaaatttgatgccactaa |
8847075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University