View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_497 (Length: 224)
Name: NF11386A_low_497
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_497 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 43 - 174
Target Start/End: Complemental strand, 45037491 - 45037360
Alignment:
| Q |
43 |
aaatttattcacacaatcaataaatcaaaatatgcattccattacttaccgctgcacaatagtgaacaaccttgactttatgaagctcaacattttcagg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037491 |
aaatttattcacacaatcaataaatcaaaatatgcattgcattacttaccgctgcacaatagtgaacaaccttgactttatgaagctcaacattttcagg |
45037392 |
T |
|
| Q |
143 |
atgacgccataacatagcaagaacaagattgt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45037391 |
gtgacgccataacatagcaagaacaagattgt |
45037360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 151
Target Start/End: Original strand, 45944023 - 45944078
Alignment:
| Q |
96 |
gcacaatagtgaacaaccttgactttatgaagctcaacattttcaggatgacgcca |
151 |
Q |
| |
|
||||||||||||||||| | ||||| | |||||||||||| |||||||||||||| |
|
|
| T |
45944023 |
gcacaatagtgaacaacttgaactttctcaagctcaacattctcaggatgacgcca |
45944078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 86 - 174
Target Start/End: Complemental strand, 20395365 - 20395277
Alignment:
| Q |
86 |
acttaccgctgcacaatagtgaacaaccttgactttatgaagctcaacattttcaggatgacgccataacatagcaagaacaagattgt |
174 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||| | ||| |||||||| |||||||||||||| ||||| || || |||||||||| |
|
|
| T |
20395365 |
acttaccgctgcacagtaatgaacaactttgactttctcaagttcaacattctcaggatgacgccacaacatggccagcacaagattgt |
20395277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 157
Target Start/End: Original strand, 37686915 - 37686983
Alignment:
| Q |
89 |
taccgctgcacaatagtgaacaaccttgactttatgaagctcaacattttcaggatgacgccataacat |
157 |
Q |
| |
|
|||||||||||| || |||||||| |||||||| | ||| |||||||| ||||| |||||||| ||||| |
|
|
| T |
37686915 |
taccgctgcacagtaatgaacaactttgactttctcaagttcaacattctcagggtgacgccacaacat |
37686983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 157
Target Start/End: Complemental strand, 37698603 - 37698535
Alignment:
| Q |
89 |
taccgctgcacaatagtgaacaaccttgactttatgaagctcaacattttcaggatgacgccataacat |
157 |
Q |
| |
|
|||||||||||| || |||||||| |||||||| | ||| |||||||| ||||| |||||||| ||||| |
|
|
| T |
37698603 |
taccgctgcacagtaatgaacaactttgactttctcaagttcaacattctcagggtgacgccacaacat |
37698535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University