View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_502 (Length: 223)
Name: NF11386A_low_502
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_502 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 8 - 223
Target Start/End: Original strand, 16315105 - 16315320
Alignment:
| Q |
8 |
ttggagttgcagggtttgaaagctgttgataatgaagagccaccaaagatattgcattttaatcctaggcttaaaggggattggagtgggaagcctgtta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16315105 |
ttggagttgcagggtttgaaagctgttgataatgaagagccaccaaagatattgcattttaatcctaggcttaaaggggattggagtgggaagcctgtta |
16315204 |
T |
|
| Q |
108 |
ttgaacagaatacttgttataggatgcaatgggggactggtcttaggtgtgagggatggaagtctcgcgcggacgaggaaactggtaatgtaaaaatgtc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16315205 |
ttgaacagaatacttgttataggatgcaatgggggactggtcttaggtgtgagggatggaagtctcgcgcggacgaggaaactggtaatgtaaaaatgtc |
16315304 |
T |
|
| Q |
208 |
ctttttgtatgcatgt |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
16315305 |
ctttttgtatgcatgt |
16315320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 32 - 172
Target Start/End: Complemental strand, 25872822 - 25872682
Alignment:
| Q |
32 |
gttgataatgaagagccaccaaagatattgcattttaatcctaggcttaaaggggattggagtgggaagcctgttattgaacagaatacttgttatagga |
131 |
Q |
| |
|
|||||||| || || ||||| |||||| ||||||||||||||||| | ||||| |||| ||||||||||| || ||||| ||||||||||||||||| | |
|
|
| T |
25872822 |
gttgataaggaggaaccacctaagatactgcattttaatcctaggttgaaaggcgattatagtgggaagccggtgattgagcagaatacttgttatagaa |
25872723 |
T |
|
| Q |
132 |
tgcaatgggggactggtcttaggtgtgagggatggaagtct |
172 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |
|
|
| T |
25872722 |
tgcaatggggttcttcacttaggtgtgagggatggaagtct |
25872682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 7 - 141
Target Start/End: Original strand, 44384579 - 44384713
Alignment:
| Q |
7 |
tttggagttgcagggtttgaaagctgttgataatgaagagccaccaaagatattgcattttaatcctaggcttaaaggggattggagtgggaagcctgtt |
106 |
Q |
| |
|
|||||||||||||||||||||| | || || |||||| ||||||| ||| |||||||| ||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
44384579 |
tttggagttgcagggtttgaaaacggtggaaggtgaagacccaccaaggattttgcatttcaatccaaggttgaaaggggattggagtgggaagcctgtt |
44384678 |
T |
|
| Q |
107 |
attgaacagaatacttgttataggatgcaatgggg |
141 |
Q |
| |
|
||||| | || |||||||||||||||| ||||| |
|
|
| T |
44384679 |
attgagcttaactcttgttataggatgcagtgggg |
44384713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University