View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_511 (Length: 220)
Name: NF11386A_low_511
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_511 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 31741369 - 31741551
Alignment:
| Q |
20 |
attagatgctcgatgaaacttttctcgttgagacaaatttcactagttatgaaatgatacacacatactaggaaatagtatattatgatttgagcttaca |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31741369 |
attagatgctcgatgaaacttttttcgttgagacaaatttcactagttatgaaatgatacacacatactaggaaatagtatattatgatttgagcttaca |
31741468 |
T |
 |
| Q |
120 |
aacattgtaactgtcacatgagaatcgttgtacaatatgctatttatagacttcaactttaggaatctgttgcacacattcat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31741469 |
aacattgtaactgtcacatgagaatcgttgtacaatatgctatttatagacttcaactttaggaatctgttgcacacattcat |
31741551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University