View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_515 (Length: 218)
Name: NF11386A_low_515
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_515 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 3332324 - 3332107
Alignment:
| Q |
1 |
ggttgtgacgttgttgaaagtgtcaacaactttgctagacgccgtcaaagaggcgtttgcatcatgagtgggacagggacggttacaaacgtgacactaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332324 |
ggttgtgacgttgttgaaagtgtcaacaacttcgctagacgccgtcaaagaggcgtttgcatcatgagtgggacagggacggttacaaacgtgacactaa |
3332225 |
T |
|
| Q |
101 |
ggcaaccggcttctcctggggctgttgttacacttcatggaaggttcgagatcctttcgctggctggatcgtttcttccaccacctgctccgcccgctgc |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332224 |
ggcaaccggcttctcctggagctgttgttacacttcatggaaggttcgagattctttcgctggctggatcgtttcttccaccacctgctccgcccgctgc |
3332125 |
T |
|
| Q |
201 |
ttctggtttgaccatata |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3332124 |
ttctggtttgaccatata |
3332107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University