View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_520 (Length: 216)
Name: NF11386A_low_520
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_520 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 17 - 181
Target Start/End: Complemental strand, 39079536 - 39079370
Alignment:
| Q |
17 |
caatatcctcaactgagaaaatgttattattcaaatcgacataaccaataaatctattggttaagtgactatggtttatgttcaatnnnnnnnntgtggt |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39079536 |
caatatcctcaactaagaaaatgttattattcaaatcgacataaccaataaatctagtggttaagtgactatggtttatgttcaat-aaaaaaatgtggt |
39079438 |
T |
|
| Q |
117 |
tgctaaccttgttatagcaccggacaactcaaacc---tgaaattcttccggttcatcccaggtttga |
181 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39079437 |
tgctaaccttgttatagcactggacaactcaaacctgatgaaattcttccggttcatcccaggtttga |
39079370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University