View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_521 (Length: 215)
Name: NF11386A_low_521
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_521 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 42799407 - 42799229
Alignment:
| Q |
16 |
ggacatcaatggttcgaaagttggggaaccaaggaactatctgatgttggtcttccccttgtgacaccaaaacagatcatcaaggtgtgtactatatcat |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799407 |
ggacttcaatggttcgaaagttggggaaccaaggaactatctgatgttggtcttccccttgtgacaccaaaacagatcatcaaggtgtgtactatatcat |
42799308 |
T |
|
| Q |
116 |
ataagctctcattgcattgaaccttgtcaagtatgaattctgcataactctagtgcatacagagtaaaatgctatcttg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799307 |
ataagctctcattgcattgaaccttgtcaagtatgaattctgcataactctagtgcatacagagtaaaatgctatcttg |
42799229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University