View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_525 (Length: 215)
Name: NF11386A_low_525
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_525 |
 | |
|
| [»] scaffold0194 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 36676289 - 36676082
Alignment:
| Q |
1 |
cgtgattataacatgcagttacatgttcttggtcgaactttagattaccagagctcccttcttctagaaactagagggctaagacnnnnnnnnnnnnctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36676289 |
cgtgattataacatgcagttacatgttcttggtcgaactttagattaccagagctcccttcttctagaaactagagggctaagacaaaaacaaaaaactg |
36676190 |
T |
|
| Q |
101 |
agtgtgtttgtttatttgttgttggtgaatgcagggtgatcaagcttctataattggaggagctattaactttgttaaagagcttgagcacaagtttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36676189 |
agtgtgtttgtttatttgttgttggtgaatgcagggtgatcaagcttctataattggaggagctattaactttgttaaagagcttgagcacaagtttcat |
36676090 |
T |
|
| Q |
201 |
attcttgg |
208 |
Q |
| |
|
||||||| |
|
|
| T |
36676089 |
tttcttgg |
36676082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 190
Target Start/End: Original strand, 46922039 - 46922099
Alignment:
| Q |
130 |
tgcagggtgatcaagcttctataattggaggagctattaactttgttaaagagcttgagca |
190 |
Q |
| |
|
|||||||||||||||| || || ||||| || ||||||||||||||||| |||||||||| |
|
|
| T |
46922039 |
tgcagggtgatcaagcatcaattattgggggtgctattaactttgttaagaagcttgagca |
46922099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 133 - 166
Target Start/End: Original strand, 26548 - 26581
Alignment:
| Q |
133 |
agggtgatcaagcttctataattggaggagctat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
26548 |
agggtgatcaagcttctataattggaggggctat |
26581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University