View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_532 (Length: 213)
Name: NF11386A_low_532
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_532 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 28586921 - 28587101
Alignment:
| Q |
19 |
gtaatatatatggatacagaatatatggggagattggtaaaatatatgagtagattaaagctaatggtgtcatacactcatactatcatttcactaaatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28586921 |
gtaatatatatggatacagaatatatggggagattggtaaaatatatcagtagattaaagttaatggtgtcatacactcatactatcatttcactaaatc |
28587020 |
T |
|
| Q |
119 |
caatcatattttataaaatagaaaagttaacaagaaaaggtaaacgtttaccatatgttcccaagtatagatctttgtttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587021 |
caatcatattttataaaatagaaaagttaacaagaataggtaaacgtttaccatatgttcccaagtatagatctttgtttc |
28587101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University