View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_545 (Length: 208)
Name: NF11386A_low_545
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_545 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 41 - 208
Target Start/End: Complemental strand, 25615002 - 25614835
Alignment:
| Q |
41 |
tagataatcacaacaatggtgaatatttagtaatgttgtattgtatctaataaattttctgtaaaatatctcatagcatattaaactcttatatgcacat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25615002 |
tagataatcacaacaatggtgaatatttagtaatgttgtattgtatctgataaattttctgtaaaatatctcgtagcatattaaactcttatatgcacat |
25614903 |
T |
 |
| Q |
141 |
taaactcatagataacacaagaaaaccacgcattgtactccaagataacacaacaaaatggatcatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614902 |
taaactcatagataacacaagaaaaccacgcattgtactccaagataacacaacaaaatggatcatca |
25614835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University