View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_554 (Length: 206)
Name: NF11386A_low_554
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_554 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 20 - 189
Target Start/End: Original strand, 20217515 - 20217685
Alignment:
| Q |
20 |
atagattgttagtatatagacatgtaatttgaattgagacaaaaatgaaaaataa-tggagtaacacatctgtacaaactgcaacgaaaaaaggtctatt |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||| |||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20217515 |
atagattgttagtatatagacaggtaatttgaattcagataaaaatgaaaaaaaaatggagtaatacatctgtacaaactgcaacgaaaaaaggtctatt |
20217614 |
T |
|
| Q |
119 |
agattcaagtgtcatgtttggagtgacgctgcaattgactgatatttgatctggttgtattatagttatag |
189 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20217615 |
agattcaagtgtcatgattggagtcacgctgcaattgactgatgtttgatctggttgtattatagttatag |
20217685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University