View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_560 (Length: 205)
Name: NF11386A_low_560
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_560 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 79 - 188
Target Start/End: Complemental strand, 22158808 - 22158699
Alignment:
| Q |
79 |
taaattataatggaaatctaagattggaagacttgaaaatggtcaaaaattatgcatcaaacttcatttattatttttgtaattcctaatctaactacat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22158808 |
taaattataatggaaatctaagattggaagacttgaaaatggtcaaaaattatgcatcaaacttcatttattatttttgtaattcctaatctaactacat |
22158709 |
T |
|
| Q |
179 |
gtgatttgat |
188 |
Q |
| |
|
|||||||||| |
|
|
| T |
22158708 |
gtgatttgat |
22158699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 22158928 - 22158885
Alignment:
| Q |
21 |
gtaatattacaagtttcttcatttgcattgtaagtgtctatctt |
64 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
22158928 |
gtaatattacaagtttctacatttgcattgtaaatgtctatctt |
22158885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University